BBa_J119014 1 BBa_J119014 HPP assembly vector 2011-08-17T11:00:00Z 2015-08-31T04:08:26Z HPP Vector Oligo designed for use in HPP solutions. New HPP vector for use in Golden Gate Assembly of Hamiltonian Path Problem constructs. EcoRI site followed by the START sticky word made available by the following BsaI site pointing left. Followed by NheI, then another BsaI site pointing right that frees up the FINISH sticky word. Followed by the PstI site. false false _613_ 0 10385 9 Not in stock false 1. Use BsaI to free up a new START word and a new FINISH word that are different from any of the Gene words (listed below). 2. NheI site in the middle for cloning in any XbaI/SpeI BioBrick fragment, such as the ccdB Death Gene or a reporter expression cassette. 3. Flanked by EcoRI and PstI sticky ends. false Caleb J. Carr annotation2125459 1 BsaI range2125459 1 11 16 annotation2125460 1 NheI range2125460 1 17 22 annotation2125462 1 FINISH word range2125462 1 29 32 annotation2125458 1 START word range2125458 1 7 10 annotation2125463 1 PstI range2125463 1 33 38 annotation2125457 1 EcoRI range2125457 1 1 6 annotation2125461 1 BsaI range2125461 1 23 28 BBa_J119014_sequence 1 aattcgtccagagaccgctagcggtctcacgagctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z