BBa_J119022 1 BBa_J119022 HPP Bsa J23100 promoter in pSB1A2 2011-10-18T11:00:00Z 2015-08-31T04:08:26Z J23100 promoter with added sticky ends due to digestion with BsaI for insert into a destination vector for HPP construct problems. J23100 promoter in pSB1A2 for BsaI/Ligase insertion into pSB111 (J100028). This is the J23100 promoter fragment designed for BsaI digestion and ligation into pSB111 vector (part #J100028)for use in Golden Gate Assembly of Hamiltonian Path Problem constructs. It is in pSB1A2 with a BsaI site on the left reading right, with word CGAC being freed up, followed by J23100 promoter, followed up by word GCGG which is freed up by the following BsaI site which reads to the left. The fragment is 57nt long after digestion. It should then be ligated into vector pSB111 (part J100028). false false _613_ 0 10385 9 Not in stock false Sticky ends must match only the destination sites and none else. Otherwise part will not work. Otherwise, J23100 is a common promoter, but the fore and aft tails must be unique to function properly. false Caleb J. Carr annotation2159867 1 Vector range2159867 1 1 21 annotation2159862 1 left sticky end CGAC range2159862 1 29 32 annotation2159865 1 1 bp range2159865 1 73 73 annotation2159868 1 Vector range2159868 1 80 98 annotation2159863 1 J23100 range2159863 1 33 68 annotation2159866 1 BsaI cuts left range2159866 1 74 79 annotation2159864 1 right sticky end GCGG range2159864 1 69 72 annotation2159860 1 1 bp range2159860 1 28 28 annotation2159861 1 BsaI cuts right range2159861 1 22 27 BBa_J119022_sequence 1 aattcgcggccgcttctagagggtctcacgacttgacggctagctcagtcctaggtacagtgctagcgcggagagacctactagtagcggccgctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z