BBa_J119023 1 BBa_J119023 RFP GGA BD18 destination vector - BbsI and BsaI 2011-12-14T12:00:00Z 2015-08-31T04:08:26Z Synthetic oligos cloned into existing part. The construct allows for the cloning and testing of new promoter sequences. It is a destination vector for Golden Gate Assembly using BsaI and Ligase. A new promoter can be derived from synthetic oligos, PCR, or a plasmid clone. The new promoter must be flanked by BsaI sites that produce the 4 nt overhangs required for assembly (see J119022). Assembly replaces the double terminator in the destination vector with the new promoter. Upon assembly, a functional new promoter will be expected to cause RFP expression. The destination vector also incorporates the BD18 bicistronic translational junction engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 0 10386 9 Not in stock false Golden Gate Assembly, replacement of TT with promoter, BD18 bicistronic translational junction engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false Samantha Huckuntod annotation2167722 1 BsaI Word 2 range2167722 1 142 145 annotation2167719 1 TT B0014 range2167719 1 40 134 annotation2167728 1 BBa_suffix range2167728 1 924 944 annotation2167721 1 BsaI Word 1 range2167721 1 29 32 annotation2167726 1 RFP E1010 with 4 pt mutations range2167726 1 243 923 annotation2167718 1 BsaI cuts left range2167718 1 34 39 annotation2167730 1 BbsI Word 1 range2167730 1 17 20 annotation2167735 1 C--> T for E. coli range2167735 1 704 704 annotation2167736 1 C--> T for E. coli range2167736 1 863 863 annotation2167731 1 BbsI cuts right range2167731 1 146 151 annotation2167733 1 C--> T for E. coli range2167733 1 260 260 annotation2167727 1 Stop E1010 range2167727 1 918 923 annotation2167723 1 BD18 bicistron range2167723 1 158 245 annotation2167717 1 BBa_prefix range2167717 1 1 22 annotation2167754 1 leader RBS range2167754 1 175 183 annotation2167734 1 C--> T for E. coli range2167734 1 545 545 annotation2167729 1 BbsI cuts left range2167729 1 23 28 annotation2167724 1 stop for BD18 range2167724 1 241 243 annotation2167732 1 BbsI Word 2 range2167732 1 154 157 annotation2167755 1 GOI RBS range2167755 1 228 236 annotation2167725 1 Start GOI range2167725 1 243 245 annotation2167720 1 BsaI cuts right range2167720 1 135 140 BBa_J119023_sequence 1 gaattcgcggccgcttctagaggtcttccgactgagacctcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattatttggtctcagcgggaagacaactaggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z