BBa_J119025 1 BBa_J119025 BD2 bicistronic translational junction - Lowest efficiency 2011-12-21T12:00:00Z 2015-10-01T11:42:55Z Synthetic DNA The BD2 bicistronic translational junction was engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. It includes an RBS that allows translation of a leader polypeptide. The leader has a second RBS embedded in it. The stop codon for the leader polypeptide overlaps with the start codon for the gene of interest. false false _613_ 606 606 61 Not in stock false The bicistronic translational junction was designed by Team Leader Vivek Mutalik at BioFAB. It is is intended to give reproducible and consistent expression for various genes of interest. false Vivek Mutalik annotation2167446 1 Start range2167446 1 33 35 annotation2167447 1 Start range2167447 1 86 88 annotation2167449 1 GOI RBS range2167449 1 71 79 annotation2167448 1 Stop range2167448 1 84 86 annotation2167445 1 leader RBS range2167445 1 19 27 BBa_J119025_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z