BBa_J119026 1 BBa_J119026 BD10 bicistronic translational junction - Low efficiency 2011-12-21T12:00:00Z 2015-10-01T11:43:18Z Synthetic DNA The BD10 bicistronic translational junction was engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. It includes an RBS that allows translation of a leader polypeptide. The leader has a second RBS embedded in it. The stop codon for the leader polypeptide overlaps with the start codon for the gene of interest. false false _613_ 606 606 61 Not in stock false The bicistronic translational junction was designed by Team Leader Vivek Mutalik at BioFAB [1]. It is is intended to give reproducible and consistent expression for various genes of interest. false Vivek Mutalik annotation2167451 1 GOI RBS range2167451 1 71 79 annotation2167450 1 leader RBS range2167450 1 19 27 annotation2167453 1 Start range2167453 1 33 35 annotation2167452 1 Stop range2167452 1 84 86 annotation2167454 1 Start range2167454 1 86 88 BBa_J119026_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcggaggatcgtttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z