BBa_J119029 1 BBa_J119029 P2 Promoter - High efficiency 2011-12-22T12:00:00Z 2015-10-01T11:36:08Z Synthetic DNA. P2 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik annotation2167465 1 -35 range2167465 1 1 17 annotation2167466 1 -10 range2167466 1 34 46 BBa_J119029_sequence 1 aaaaagagtattgacttcgcatctttttgtacctataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z