BBa_J119033 1 BBa_J119033 P14 Promoter - Medium efficiency 2011-12-22T12:00:00Z 2015-10-01T11:41:31Z Synthetic DNA. P14 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. Derived from pTrc promoter. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik BBa_J119033_sequence 1 ttgacaattaatcatccggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z