BBa_J119037 1 BBa_J119037 HPP START half-edge with pTet 2011-12-22T12:00:00Z 2015-08-31T04:08:26Z Synthetic DNA. Half-edge for use in solving a Hamiltonian Path Problem with Golden Gate Assembly. Digestion with BsmBI makes half-edge word GTGG available during simulataneous ligation. Digestion with BsaI makes START word of GTCC available. false false _613_ 0 606 61 Not in stock false Use of pTac promoter. false Todd Eckdahl annotation2167574 1 BsaI Forward range2167574 1 6 11 annotation2167576 1 Half-edge word range2167576 1 71 74 annotation2167578 1 pTet range2167578 1 17 70 annotation2167575 1 START word range2167575 1 13 16 annotation2167577 1 BsmBI reverse range2167577 1 76 81 BBa_J119037_sequence 1 aattcggtctcagtcctccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgtggagagacgctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z