BBa_J119044 1 BBa_J119044 RFP GGA destination vector BsaI 2012-01-06T12:00:00Z 2015-08-31T04:08:26Z De novo DNA synthesis. The construct allows for the cloning and testing of new promoter sequences. It is a destination vector for Golden Gate Assembly using BsaI and Ligase, based on part J100028. A new promoter can be derived from synthetic oligos, PCR, or a plasmid clone. The new promoter must be flanked by BsaI sites that produce the 4 nt overhangs required for assembly (see J119022). Assembly replaces the double terminator in the destination vector with the new promoter. Upon assembly, a functional new promoter will be expected to cause RFP expression. The destination vector also incorporates the BD18 bicistronic translational junction (see J119024) engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_435_ 0 606 61 Not in stock false Golden Gate Assembly, replacement of TT with promoter, BD18 bicistronic translational junction engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false Todd Eckdahl and A. Malcolm Campbell annotation2180017 1 Double Stop range2180017 1 900 905 annotation2180008 1 TT B0014 range2180008 1 34 128 annotation2180016 1 RFP optimized for E. coli range2180016 1 225 905 annotation2180012 1 leader RBS range2180012 1 157 165 annotation2180006 1 BsaI sticky end left range2180006 1 23 26 annotation2180009 1 Bsa cuts right range2180009 1 129 134 annotation2180010 1 BsaI sticky end right range2180010 1 136 139 annotation2180014 1 Stop for BD18 range2180014 1 223 225 annotation2180018 1 BBa suffix range2180018 1 906 926 annotation2180013 1 RFP RBS range2180013 1 210 218 annotation2180007 1 BsaI cuts left range2180007 1 28 33 annotation2180011 1 BD18 bicistron range2180011 1 140 227 annotation2180005 1 Bba prefix range2180005 1 1 22 annotation2180015 1 Start RFP range2180015 1 225 227 BBa_J119044_sequence 1 gaattcgcggccgcttctagagcgactgagacctcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattatttggtctcagcgggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatggcaagcagcgaagatgtgatcaaagaatttatgcgtttcaaggtgcgtatggaaggtagcgttaatggtcatgaatttgaaattgaaggtgaaggcgaaggtcgtccgtatgaaggcacccagaccgcaaaactgaaagttaccaaaggtggtccgctgccgtttgcatgggatattctgagtccgcagttccagtatggtagcaaagcatatgttaaacatccggcagatattccggattacctgaaactgagctttccggaaggttttaaatgggaacgtgtgatgaattttgaagatggtggtgttgttaccgttacccaggatagcagcttacaggatggtgagtttatctacaaagttaaactgcgtggcaccaactttccgagtgatggtccggttatgcagaaaaaaaccatgggttgggaagcaagcaccgaacgtatgtatccggaagatggcgcactgaaaggtgaaatcaaaatgcgtctgaagctgaaagacggtggtcattatgatgcagaagttaaaaccacctacatggccaaaaaaccggttcagctgcctggtgcatataaaaccgatattaaactggatatcaccagccacaacgaggattataccattgtggaacagtatgaacgtgcagaaggtcgccatagtaccggtgcctaataatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z