BBa_J119052 1 BBa_J119052 J23100 promoter for BsaI GGA 2012-01-25T12:00:00Z 2015-08-31T04:08:26Z de novo DNA synthesis J23100 promoter flanked by BsaI sites for use in Golden Gate Assembly. The 5' word is CGAC and the 3' word is GCGG. The part can be assembled into J119023 using these words. false false _613_435_ 0 606 61 Not in stock false The 5' word is CGAC and the 3' word is GCGG. The part can be assembled into J119023 using these words. false David Carr annotation2169747 1 Word 2 range2169747 1 47 50 annotation2169748 1 J23100 promoter range2169748 1 12 46 annotation2169744 1 BsaI forward range2169744 1 1 6 annotation2169746 1 Word 1 range2169746 1 8 11 annotation2169745 1 BsaI reverse range2169745 1 52 57 BBa_J119052_sequence 1 ggtctcacgacttgacggctagctcagtcctaggtacagtgctagcgcggagagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z