BBa_J119053 1 BBa_J119053 J23100 Promoter with BD18 RBS w/ leader and RFP reporter 2012-01-25T12:00:00Z 2015-08-31T04:08:26Z de novo, selected sequence The sequence contains a J23100 promoter followed by the BD18 leader RBS. The promoter has two BsaI sites, one at each end of the sequence. The one on the 5' end of J23100 cuts to the left, and the one at the 3' end of J23100 cuts to the right. There are also two BbsI sites, one is up stream from the 5' BsaI site and cuts to the left, while the other is down stream from the 3' BsaI site and cuts to the right. This is followed by an RFP gene starting with the second codon. false false _613_ 0 10387 9 Not in stock false The promoter has two BsaI sites, one at each end of the sequence. The one on the 5' end of J23100 cuts to the left, and the one at the 3' end of J23100 cuts to the right. There are also two BbsI sites, one is up stream from the 5' BsaI site and cuts to the left, while the other is down stream from the 3' BsaI site and cuts to the right. false David Carr annotation2169817 1 BbsI cuts left range2169817 1 23 28 annotation2169830 1 C--> T for E. coli range2169830 1 471 471 annotation2169834 1 BBa_suffix range2169834 1 850 870 annotation2169827 1 Start GOI range2169827 1 169 171 annotation2169816 1 BbsI Word 1 range2169816 1 17 20 annotation2169831 1 C--> T for E. coli range2169831 1 630 630 annotation2169819 1 J23100 range2169819 1 33 67 annotation2169821 1 BbsI cuts right range2169821 1 72 77 annotation2169832 1 C--> T for E. coli range2169832 1 789 789 annotation2169825 1 GOI RBS range2169825 1 154 162 annotation2169833 1 Stop E1010 range2169833 1 844 849 annotation2169815 1 BBa_prefix range2169815 1 1 22 annotation2169824 1 leader RBS range2169824 1 101 109 annotation2169829 1 C--> T for E. coli range2169829 1 186 186 annotation2169828 1 RFP E1010 with 4 pt mutations range2169828 1 169 849 annotation2169820 1 BsaI Word 2 range2169820 1 68 71 annotation2169823 1 BD18 Bicistron range2169823 1 84 171 annotation2169822 1 BbsI Word 2 range2169822 1 80 83 annotation2169818 1 Bsa1 Word 1 range2169818 1 29 32 annotation2169826 1 stop for BD18 range2169826 1 167 169 BBa_J119053_sequence 1 gaattcgcggccgcttctagaggtcttccgacttgacggctagctcagtcctaggtacagtgctagcgcgggaagacaactaggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z