BBa_J119086 1 BBa_J119086 Finish Node for GGA/HPP 2.0 2012-03-09T12:00:00Z 2015-08-31T04:08:27Z de novo This part is one of several similar parts designed in our lab to serve as "Nodes" in a Hamiltonian Path Problem experiment using Golden Gate Assembly. This part contains four Type II restriction enzymes (BsaI, BbsI, PstI, and EcoRI) cutting sights which flank a "Gene of Interest", which in this case is a B10006 Terminator. false false _613_ 0 10387 9 Not in stock false This part contains four Type II restriction enzymes (BsaI, BbsI, PstI, and EcoRI) cutting sights which flank a "Gene of Interest", which in this case is a B10006 Terminator. false David Carr annotation2170631 1 EcoRI cuts left range2170631 1 5 10 annotation2170637 1 PstI cuts right range2170637 1 72 77 annotation2170635 1 Exit Word (Finish) range2170635 1 61 64 annotation2170634 1 Finish Node range2170634 1 22 60 annotation2170632 1 BbsI cuts right range2170632 1 11 16 annotation2170633 1 BbsI word (Node Word) range2170633 1 18 21 annotation2170630 1 EcoRI Word range2170630 1 1 4 annotation2170636 1 BsaI cuts left range2170636 1 66 71 BBa_J119086_sequence 1 gaattcgaagacaaatgaaaaaaaaaccccgcccctgacagggcggggttttttttcgagtgagaccctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z