BBa_J119124 1 BBa_J119124 trpR, tryptophan-repressor, represses the Promoter-tryp when tryp is high 2012-09-16T11:00:00Z 2015-08-31T04:08:27Z Primers were used to "pull" this part from the E. coli genome. This is the tryptophan-Repressor, which represses the tryptophan-promoter (BBa_J119124), when tryptophan has reached a high enough concentration in the cell. Designed to be part of a selection module for optimization of the tryptophan operon, its intended function is to down-regulate or entirely shut off a gene promoted by the Ptrp, said gene having a negative effect on the cell in some way. false false _613_ 0 10385 9 In stock false NA false Caleb J. Carr annotation2188558 1 trpR: tryptophan repressor range2188558 1 1 327 BBa_J119124_sequence 1 atggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcatcgcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z