BBa_J119031 1 BBa_J119031 P5 Promoter - Highest efficiency 2011-12-22T12:00:00Z 2015-10-01T11:40:06Z Synthetic DNA. P2 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik BBa_S05028 1 BBa_S05028 J119031:J119028 2012-01-09T12:00:00Z 2015-05-08T01:14:48Z false false _61_ 0 201 61 Not in stock false false Malcolm Campbell component2169470 1 BBa_J119031 component2169476 1 BBa_J119028 annotation2169476 1 BBa_J119028 range2169476 1 37 124 annotation2169470 1 BBa_J119031 range2169470 1 1 36 BBa_J119124 1 BBa_J119124 trpR, tryptophan-repressor, represses the Promoter-tryp when tryp is high 2012-09-16T11:00:00Z 2015-08-31T04:08:27Z Primers were used to "pull" this part from the E. coli genome. This is the tryptophan-Repressor, which represses the tryptophan-promoter (BBa_J119124), when tryptophan has reached a high enough concentration in the cell. Designed to be part of a selection module for optimization of the tryptophan operon, its intended function is to down-regulate or entirely shut off a gene promoted by the Ptrp, said gene having a negative effect on the cell in some way. false false _613_ 0 10385 9 In stock false NA false Caleb J. Carr annotation2188558 1 trpR: tryptophan repressor range2188558 1 1 327 BBa_J119028 1 BBa_J119028 BD24 bicistronic translational junction - Highest efficiency 2011-12-21T12:00:00Z 2015-10-01T11:44:13Z Synthetic DNA. The BD24 bicistronic translational junction was engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. It includes an RBS that allows translation of a leader polypeptide. The leader has a second RBS embedded in it. The stop codon for the leader polypeptide overlaps with the start codon for the gene of interest. false false _613_ 606 606 61 Not in stock false The bicistronic translational junction was designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org]. It is is intended to give reproducible and consistent expression for various genes of interest. false Vivek Mutalik annotation2167462 1 Stop range2167462 1 84 86 annotation2167460 1 Start range2167460 1 33 35 annotation2167464 1 GOI RBS range2167464 1 71 79 annotation2167463 1 leader RBS range2167463 1 19 27 annotation2167461 1 Start range2167461 1 86 88 BBa_J119126 1 BBa_J119126 P5-Bd24 ligated to trpR (S05028+J119124) 2012-09-27T11:00:00Z 2015-08-31T04:08:27Z The S05028 part was synthesized by the Davidson team, and the J119124 part was cloned out of the native genome of E. coli using primers. This part is a Promoter-cDog-trpR (tryptophan repressor gene) that will feed back into the tryptophan promoter when tryptophan is in high enough concentration. It is designed to be used in conjunction with the tryptophan operon optimization experiments. false false _613_ 0 10385 9 Not in stock false The scar that would result, as it ends up just between the cDog and the gene to be translated. false Caleb J. Carr component2203830 1 BBa_S05028 component2203832 1 BBa_J119124 annotation2203830 1 BBa_S05028 range2203830 1 1 124 annotation2203832 1 BBa_J119124 range2203832 1 131 457 BBa_J119031_sequence 1 ttgacaattaatcatccggctcgtaatttatgtgga BBa_J119126_sequence 1 ttgacaattaatcatccggctcgtaatttatgtggagggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgatggacggtttctaatgtactagatggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcatcgcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattga BBa_J119028_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgatggacggtttctaatg BBa_S05028_sequence 1 ttgacaattaatcatccggctcgtaatttatgtggagggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgatggacggtttctaatg BBa_J119124_sequence 1 atggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcatcgcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z