BBa_J119129 1 BBa_J119129 pTac with mutations 2013-01-07T12:00:00Z 2015-08-31T04:08:27Z Oligonucleotides. This part was designed to see the effects of mutations on a functional promoter. Golden Gate Assembly was used to insert the mutations into Part J100091 at the double terminator sites. A mutation was created by removing the ATTA sequence after the -35 location. This had the effect of reducing the spacing between the -35 and -10 elements from 16 base pairs to 12 base pairs. false false _613_435_ 0 606 61 Not in stock false The oligonucleotides needed to have sticky ends compatible with those produced by BsaI digestion of J100091 so that Golden Gate Assembly could be used. false MWSU Genetics Lab Fall 2012 Tues 8:00 annotation2213801 1 -35 region range2213801 1 11 16 annotation2213802 1 -10 region range2213802 1 29 34 BBa_J119129_sequence 1 cgacgagctgttgacaatcatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z