BBa_J119130 1 BBa_J119130 pTac with mutations 2013-01-07T12:00:00Z 2015-08-31T04:08:27Z The oligonucleotides needed to have sticky ends compatible with those produced by BsaI digestion of J100091 so that Golden Gate Assembly could be used. This part was designed to see the effects of mutations on a functional promoter. Golden Gate Assembly was used to insert the mutations into Part J100091 at the double terminator sites. This mutation was created by changing the third base of the -35 region from a G to a W. false false _613_435_ 0 606 61 Not in stock false Oligonucleotides. false MWSU Genetics Lab Fall 2012 Tues 8:00 annotation2213804 1 a/c/g/t range2213804 1 13 13 annotation2213805 1 -10 region range2213805 1 32 37 annotation2213803 1 -35 region range2213803 1 11 14 BBa_J119130_sequence 1 cgacgagctgttacaattaatcatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z