BBa_J119133 1 BBa_J119133 pTac with mutations 2013-01-07T12:00:00Z 2015-08-31T04:08:27Z The oligonucleotides needed to have sticky ends compatible with those produced by BsaI digestion of J100091 so that Golden Gate Assembly could be used. This part was designed to see the effects of mutations on a functional promoter. Golden Gate Assembly was used to insert the mutations into Part J100091 at the double terminator sites. Mutation of pTac Promoter substitution of 3rd nt from A to T in the -10 element false false _613_435_ 0 606 61 Not in stock false Oligonucleotides. false MWSU Genetics Lab Fall 2012 2:00 annotation2213809 1 -35 region range2213809 1 11 15 annotation2213810 1 -10 region range2213810 1 33 37 BBa_J119133_sequence 1 cgacgagctgtttacaattaatcatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z