BBa_J119142 1 BBa_J119142 Part for inserting modified D-Dogs for Golden Gate Assembly using BsgI 2013-05-07T11:00:00Z 2015-08-31T04:08:27Z Part is mostly nonsense except for restriction enzyme recognition sequence. This part is a modification of the J100091 construct that removes the C-Dog part and inserts a placeholder fragment with two BsgI sites that both face out from the center of the insert. This part is the precursor to introducing modified C-Dog parts with nested BsgI or BpmI sites to be used in Golden Gate Assembly. This part was designed to complete the library of functional parts being used in the design of a generalized method for optimizing a metabolic pathway. false false _613_ 0 10385 9 Not in stock false To insert this part, oligonucleotides had to be ordered, annealed, and treated with polynucleotide kinase from the BBA prefix to around 110 NT into the mRFP gene where a rogue BsiWI site was discovered. This approach swapped the original ~330 NT from J100091 with a fragment around 220 NT long. However, the mRFP gene was left in tact while the C-Dog element was removed completely. false Caleb J. Carr annotation2217787 1 "Stuffer" (non-functional) range2217787 1 59 106 annotation2217783 1 J119030 range2217783 1 12 45 annotation2217784 1 BsaI (right) range2217784 1 48 53 annotation2217793 1 Stop range2217793 1 781 783 annotation2217791 1 mRFP range2217791 1 106 786 annotation2217786 1 BsgI sticky word (left) range2217786 1 59 60 annotation2217782 1 BsaI (left) range2217782 1 6 11 annotation2217789 1 BsgI (right) range2217789 1 85 90 annotation2217785 1 Sticky word range2217785 1 55 58 annotation2217790 1 BsgI Sticky word (right) range2217790 1 105 106 annotation2217788 1 BsgI (left) range2217788 1 75 80 annotation2217781 1 Sticky word range2217781 1 1 4 annotation2217792 1 Start Codon range2217792 1 106 108 annotation2217794 1 Stop range2217794 1 784 786 BBa_J119142_sequence 1 cgaccgagaccttgacatcaggaaaatttttctgtataatgtgtggaggtctcagcggcaactggctcaccttcctgcacgcatgtgcaggggtgggcctttcgaatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z