BBa_J119300 1 BBa_J119300 Part for inserting modified D-Dogs for Golden Gate Assembly using BsgI 2013-05-07T11:00:00Z 2015-08-31T04:08:27Z This is a place holder part only. It has no functionality, thus upon successfully replacing this part with a functional modified C-Dog, expression of mRFP will occur. This part is a modification of the J100091 part that introduces a modified, non-functional, C-Dog placeholder that when digested with BsgI will allow for insertion of a C-Dog with nested BsgI or BpmI sites. This now allows for the treatment of the C-Dog part as a swappable library tool. The design of this part is to allow the C-Dog library of parts to become "swappable" in conjunction with optimizing a metabolic network/circuit. true false _613_ 0 10385 9 Discontinued false The C-Dog parts share a -3 NT overlap with the subsequent coding sequence, making them difficult to swap as part of a library false Caleb J. Carr annotation2217179 1 BsaI sticky end right range2217179 1 136 139 annotation2217183 1 Stop for BD18 leader range2217183 1 223 225 annotation2217181 1 leader RBS range2217181 1 157 165 annotation2217187 1 BBa suffix range2217187 1 906 926 annotation2217188 1 BBa_J100091 range2217188 1 1 926 annotation2217174 1 BBa Prefix range2217174 1 1 22 annotation2217175 1 BsaI sticky end left range2217175 1 23 26 annotation2217185 1 RFP E1010 range2217185 1 225 905 annotation2217177 1 TT B0014 range2217177 1 34 128 annotation2217184 1 Start for RFP range2217184 1 225 227 annotation2217178 1 BsaI cuts right range2217178 1 129 134 annotation2217186 1 Double Stop for E1010 range2217186 1 900 905 annotation2217180 1 BD18 bicistron range2217180 1 140 227 annotation2217182 1 RBS for RFP range2217182 1 210 218 annotation2217176 1 BsaI cuts left range2217176 1 28 33 BBa_J100091 1 BBa_J100091 For Testing New Promoters via Golden Gate Assembly 2012-08-19T11:00:00Z 2015-08-31T04:08:22Z This part was engineered by Todd Eckdahl and Malcolm Campbell. They devised this as part of a national effort to have undergraduates contribute to a registry of functional promoters (RFP; [http://gcat.davidson.edu/RFP/ Registry of Functional Promoters]). There is a very similar part called J119044 [[Part:BBa_J119044]]. The only difference between these two parts is that J00091 uses E1010 [[Part:BBa_E1010]] version of RFP while [[Part:BBa_J119044]] uses an E. coli-optimized set of codons and was produced by GeneArt. The construct allows for the cloning and testing of new promoter sequences. It is a destination vector for Golden Gate Assembly using BsaI and Ligase, based on part [[Part:BBa_J100028]]. A new promoter can be derived from synthetic oligos, PCR, or a plasmid clone. The new promoter must be flanked by BsaI sites that produce the 4 nt overhangs required for assembly (see [[Part:BBa_J119022]]). Assembly replaces the double terminator in the destination vector with the new promoter. Upon assembly, a functional new promoter will be expected to cause RFP expression. The destination vector also incorporates the BD18 bicistronic translational junction (see [[Part:BBa_J119024]]) engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false true _578_ 0 201 61 Not in stock true The major question is what plasmid to use. Since both [[Part:BBa_J119044]] and [[Part:BBa_J100091]] both contain a transcriptional terminator (TT), this may lead to recombination if more than two TTs are in the same plasmid. We have some evidence that [[Part:BBa_J119044]] can undergo some recombination when cloned into the plasmid pSB1A8 [[Part:BBa_J119043]]. Therefore, we recommend [[Part:BBa_J119044]] and [[Part:BBa_J100091]] be cloned into a modified version of pSB1A2 that has the Bsa I site removed from the ampicillin gene. We call this modified plasmid pSB1A2 BR for Bsa I Removed. false Malcolm Campbell and Todd Eckdahl annotation2180198 1 RFP E1010 range2180198 1 225 905 annotation2330898 1 PCR Rev Primer range2330898 1 232 251 annotation2180188 1 BsaI sticky end left range2180188 1 23 26 annotation2330897 1 PCR For Primer range2330897 1 1 20 annotation2180200 1 BBa suffix range2180200 1 906 926 annotation2180192 1 BsaI sticky end right range2180192 1 136 139 annotation2180193 1 BD18 bicistron range2180193 1 140 227 annotation2180190 1 TT B0014 range2180190 1 34 128 annotation2180194 1 leader RBS range2180194 1 157 165 annotation2180197 1 Start for RFP range2180197 1 225 227 annotation2180195 1 RBS for RFP range2180195 1 210 218 annotation2180196 1 Stop for BD18 leader range2180196 1 223 225 annotation2180199 1 Double Stop for E1010 range2180199 1 900 905 annotation2180189 1 BsaI cuts left range2180189 1 28 33 annotation2180191 1 BsaI cuts right range2180191 1 129 134 annotation2180187 1 BBa Prefix range2180187 1 1 22 BBa_J100091_sequence 1 gaattcgcggccgcttctagagcgactgagacctcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattatttggtctcagcgggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataatactagtagcggccgctgcag BBa_J119300_sequence 1 gaattcgcggccgcttctagagcgactgagacctcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattatttggtctcagcgggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z