BBa_J119301 1 BBa_J119301 Scaffold Sequence for J-GGA 2013-06-10T11:00:00Z 2015-08-31T04:08:27Z N/A The scaffold consist of four junctions, which allow to insert parts(promoters.RBS,Genes)between junctions A and Junction B,Junction B and Junction C or the Junction C and Junction D. false false _613_435_ 0 606 61 Not in stock false N/A false Todd Eckdahl, Sachith Polpitiya Arachchige annotation2329393 1 Junction D range2329393 1 66 84 annotation2329390 1 Junction A range2329390 1 1 18 annotation2329391 1 Junction B range2329391 1 22 39 annotation2329392 1 Junction C range2329392 1 45 61 BBa_J119301_sequence 1 atagtctgttcatggtgcacgttattgatgtagttaaggccggatttctaatggggaccatcttagttaagctatgtattcctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z