BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_J119305 1 BBa_J119305 T5 promoter + Theo riboswitch + RFP 2013-06-12T11:00:00Z 2015-08-31T04:08:28Z J100065, E1010 The combination of Riboswitch (J100065) and RFP(E1010). It was assembled using Biobrick Cloning. false false _613_435_ 0 606 61 Not in stock false N/A false Todd Eckdahl component2329441 1 BBa_E1010 component2329438 1 BBa_J100065 annotation2329438 1 BBa_J100065 range2329438 1 1 213 annotation2329441 1 BBa_E1010 range2329441 1 220 925 BBa_J100065 1 BBa_J100065 Synthetic Riboswitch 2012-06-10T11:00:00Z 2015-08-31T04:08:22Z http://www.ncbi.nlm.nih.gov/pubmed?term=Synthetic%20Riboswitches%20That%20Induce%20Gene%20Expression%20in%20Diverse%20Bacterial%20Species This part is a synthetic riboswitch that can be used in E. coli. In the presence of theophylline, the expression of the gene of interest is induced, but in the absence of theophylline, very little transcription takes place. This part contains a modified T5 promoter, which, in the absence of cymR, acts as a strong constitutive promoter. The ribosomal binding site is contained in the riboswitch. false false _578_ 0 10704 9 Not in stock false Because the riboswitch must be directly beside the gene of interest (the start codon is used in the folding of the riboswitch), we added a BsaI recognition site. This allows the riboswitch to be connected directly to a gene of interest using the Golden Gate Assembly method (if the first nucleotide after the start codon of the gene of interest is a C, we made it for use with superfolder GFP). false Rebecca Evans annotation2176244 1 BBa suffix range2176244 1 193 213 annotation2176242 1 Start range2176242 1 182 184 annotation2176236 1 lac operator range2176236 1 76 96 annotation2176241 1 RBS range2176241 1 168 172 annotation2176235 1 T5 promoter range2176235 1 23 75 annotation2176234 1 BBa prefix range2176234 1 1 22 annotation2176239 1 KpnI site range2176239 1 119 124 annotation2176243 1 GGA prefix ATGC sticky word range2176243 1 182 192 annotation2176240 1 Riboswitch range2176240 1 125 184 annotation2176238 1 constant sequence range2176238 1 104 118 annotation2176237 1 scar range2176237 1 97 102 BBa_J100065_sequence 1 gaattcgcggccgcttctagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagatacgactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatgctgagacctactagtagcggccgctgcag BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_J119305_sequence 1 gaattcgcggccgcttctagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagatacgactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatgctgagacctactagtagcggccgctgcagtactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z