BBa_J119314 1 BBa_J119314 Scaffold 2.0 for J-GGA 2013-10-04T11:00:00Z 2015-08-31T04:08:28Z Synthetic oligonucleotides. Scaffold 2.0 allows the use of BsaI Junction Golden Gate Assembly (J-GGA) to build a gene expression cassette. The vector is prepared by inverted PCR (iPCR) using primers with BsaI sites that produce 5' overhanging sticky ends for the junctions involved. The insert either has the same sticky ends or carries BsaI sites that produce them. J-GGA is then performed with BsaI and T4 DNA Ligase. false false _613_435_ 0 606 61 Not in stock false Scaffold 2.0 was designed by GGAJET (http://gcat.davidson.edu/SynBio13/GGAJET/). false Todd Eckdahl annotation2369451 1 Junction D (3' sticky end) range2369451 1 102 105 annotation2369440 1 Junction B (5' sticky end) range2369440 1 44 47 annotation2369437 1 Junction B range2369437 1 44 61 annotation2369441 1 Junction B (3' sticky end) range2369441 1 57 60 annotation2369436 1 Junction A range2369436 1 22 39 annotation2369438 1 Junction C range2369438 1 66 83 annotation2369439 1 Junction A (3' sticky end) range2369439 1 37 40 annotation2369450 1 Junction D range2369450 1 88 102 annotation2369443 1 Junction C (3 range2369443 1 79 82 annotation2369452 1 Junction A (5' sticky end) range2369452 1 22 25 annotation2369444 1 Junction D (5' sticky end) range2369444 1 88 91 annotation2369442 1 Junction C (5' Sticky end) range2369442 1 66 69 BBa_J119314_sequence 1 aattcgcggccgcttctagagccgtatacacagaggaccacgttgggtcttgaaccaggagcggagtgctaatgactgtgcgattaggcctaacgaacagacagctactagtagcggccgctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z