BBa_J119315 1 BBa_J119315 Scaffold 2.0 for J-GGA (With the promoter between Junction A and B) 2013-10-04T11:00:00Z 2015-08-31T04:08:28Z Synthesized Oligos Scaffold 2.0 with the promoter in the junction A.The vector is prepared by inverted PCR (iPCR) using primers with BsaI sites that produce 5' overhanging sticky ends for the junctions A and Junction B. The promoter has the same sticky ends.J-GGA is then performed with BsaI and T4 DNA Ligase. false false _613_435_ 0 606 61 Not in stock false N/A false Todd Eckdahl annotation2369449 1 Junction D range2369449 1 119 137 annotation2369446 1 Junction A range2369446 1 22 39 annotation2369448 1 Junction C range2369448 1 98 114 annotation2369447 1 Junction B range2369447 1 76 98 annotation2369445 1 P5 highest J119031 range2369445 1 39 75 BBa_J119315_sequence 1 aattcgcggccgcttctagagccgtatacacagaggaccttgacaattaatcatccggctcgtaatttatgtggatgggtcttgaaccaggagcggagtgctaatgactgtgcgattaggcctaacgaacagacagctactagtagcggccgctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z