BBa_J119324 1 BBa_J119324 pTac mutant -8 AA deletion 2013-11-18T12:00:00Z 2015-08-31T04:08:28Z Synthetic oligonucleotides. This part was designed and clone by students in the Missouri Western State University Genetics class of Fall 2013. It was cloned into the pClone Green vector (BBa_J119137) using Golden Gate Assembly and synthetic oligonucleotides. The mutation is an insertion of CCA at position -12. The mutation had a large negative effect on the function of the promoter (see Experience page). false false _613_435_ 0 606 61 Not in stock false Left sticky end of CGAC and right sticky end of CCGC. No BsaI sites allowed. false MWSU Genetics Fall 2013 Tuesday 2:00 lab annotation2371408 1 AA deleted range2371408 1 31 31 annotation2371406 1 -35 region range2371406 1 7 12 BBa_J119324_sequence 1 gagctgttgacaattaatcatcggctcgtattgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z