BBa_J119327 1 BBa_J119327 P5 promoter + Ammeline Riboswitch M6C 2013-12-19T12:00:00Z 2015-08-31T04:08:28Z Synthetic DNA. The P5 promoter drives a riboswitch (M6C'') that allows tranlsation in the presence of ammeline (made by demethylation of melamine). The clone also has a BsaI GGA site for insertion of a fitness or reporter gene. false false _613_435_ 0 606 61 Not in stock false None. false Jesse Campbell, Brandon Grieshaber, Sara Pearson, Sachii Polpitya Arachchige annotation2371760 1 Ammeline Riboswitch range2371760 1 73 188 annotation2371759 1 P5 promoter range2371759 1 19 55 BBa_J119327_sequence 1 ccgtatacacagaggaccttgacaattaatcatccggctcgtaatttatgtggatgggtcttgaaccaggagtcaacgcttcatataatccgaatgatatggtttcggagcttccaccaagagccttaaactcttgactatgaagtctgtcgctttatccgaaattttataaagagaagactatgaagtgagacccgaaggtctcagcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z