BBa_J119367 1 BBa_J119367 tClone: Device for Testing Transciptional Terminators and Riboswitches via Golden Gate Assembly 2014-08-26T11:00:00Z 2015-08-31T04:08:28Z IDT G block tClone is a construction intermediate that can be used to build devices that will allow users to clone and test new transcriptional terminators and riboswitches that function by antitermination without gel purification or other preparation of DNA. Use of BioBrick cloning to add the RFP gene into the suffix of tClone produce tClone Red, which can be used as a reporter for cloning and testing new transcriptional terminators and riboswitches. Similarly, use of BioBrick cloning to insert the TetA gene into the suffix of tClone produces tClone TetA, which can be used to measure new transcriptional terminators and riboswitches. tClone vectors can be used as destination vectors for Golden Gate Assembly (GGA) using BsaI and ligase. A new terminator or riboswitch can be derived from synthetic oligos, PCR, or a plasmid clone. For proper assembly, the new insert must have the appropriate 4 nt sticky ends or be flanked by BsaI sites that produce the sticky ends. With reference to the top strand, the left site must be 5' CGAC 3' and the right site must be 5' GCGG 3'. BsaI always produces a 5' overhang sticky end. Successful GGA assembly replaces the reverse promoter driving GFP expression with the new terminator or riboswitch. Transcription will be initiated in the direction of the RFP coding sequence. Whether or not transcription proceeds to the RFP gene is determined by the strength of the terminator or whether termination or antitermination occurs at the riboswitch. The part incorporates the BD18 bicistronic translational junction (see Part:BBa_J119024) engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_435_ 0 606 61 Not in stock false None false Todd Eckdahl annotation2381650 1 BsaI Left range2381650 1 42 47 annotation2381651 1 L3SP22 Txn Terminator range2381651 1 48 104 annotation2381649 1 P5 Promoter range2381649 1 1 36 annotation2381652 1 GFP range2381652 1 112 831 annotation2381654 1 P2 Promoter rev range2381654 1 860 905 annotation2381656 1 BsaI Right range2381656 1 958 963 annotation2381653 1 B0030 RBS rev range2381653 1 838 852 annotation2381655 1 LS1P53 Txn Terminator range2381655 1 906 957 BBa_J119367_sequence 1 ttgacaattaatcatccggctcgtaatttatgtggacgactgagaccctcggtaccaaattccagaaaagaggccgcgaaagcggccttttttcgttttggtccactagagttattatttgtatagttcatccatgccatgtgtaatcccagcagctgttacaaactcaagaaggaccatgtgatctctcttttcgttgggatctttcgaaagggcagattgtgtggacaggtaatggttgtctggtaaaaggacagggccatcgccaattggagtattttgttgataatggtctgctagttgaacgcttccatcttcaatgttgtgtctaattttgaagttaactttgattccattcttttgtttgtctgccatgatgtatacattgtgtgagttatagttgtattccaatttgtgtccaagaatgtttccatcttctttaaaatcaataccttttaactcgattctattaacaagggtatcaccttcaaacttgacttcagcacgtgtcttgtagttcccgtcatctttgaaaaatatagttctttcctgtacataaccttcgggcatggcactcttgaaaaagtcatgctgtttcatatgatctgggtatctcgcaaagcattgaacaccataaccgaaagtagtgacaagtgttggccatggaacaggtagttttccagtagtgcaaataaatttaagggtaagttttccgtatgttgcatcaccttcaccctctccactgacagaaaatttgtgcccattaacatcaccatctaattcaacaagaattgggacaactccagtgaaaagttcttctcctttacgcatctagtatttctcctctttaattactagatccacacattataggtacaaaaagatgcgaagtcaatactctttttccaattattgaaggcctcccaaatcggggggccttttttattgataacaaaaggtctctgcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z