BBa_J119368 1 BBa_J119368 Ptac mutant -40 G Deletion 2014-11-07T12:00:00Z 2015-08-31T04:08:28Z Left sticky end of CGAC and right sticky end of CCGC. No BsaI sites allowed. This part was designed and clone by students in the Missouri Western State University Genetics class of Fall 2014. It was cloned into the pClone Red vector (BBa_J119137) using Golden Gate Assembly and synthetic oligonucleotides. The mutation deletes the G at position -40. The mutation had a minimal effect on the function of the promoter (see Experience page). false false _613_435_ 0 606 61 Not in stock false Left sticky end of CGAC and right sticky end of CCGC. No BsaI sites allowed. false MWSU Genetics Fall 2014 Tuesday 8:00 lab annotation2430166 1 -40 G deletion range2430166 1 1 1 annotation2430168 1 -35 region range2430168 1 6 11 annotation2430167 1 -10 region range2430167 1 28 33 BBa_J119368_sequence 1 agctgttgacaattaatcatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z