BBa_J119369 1 BBa_J119369 Ptac mutant -28 T Insertion 2014-11-07T12:00:00Z 2015-08-31T04:08:28Z Synthetic oligonucleotides. This part was designed and clone by students in the Missouri Western State University Genetics class of Fall 2014. It was cloned into the pClone Red vector (BBa_J119137) using Golden Gate Assembly and synthetic oligonucleotides. The mutation inserts a T at position -28. The mutation had a minimal effect on the function of the promoter (see Experience page). false false _613_435_ 0 606 61 Not in stock false Left sticky end of CGAC and right sticky end of CCGC. No BsaI sites allowed. false MWSU Genetics Fall 2014 Tuesday 8:00 lab annotation2430170 1 -10 region range2430170 1 30 35 annotation2430169 1 T insertion range2430169 1 13 13 annotation2430171 1 -35 region range2430171 1 7 12 BBa_J119369_sequence 1 gagctgttgacatattaatcatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z