BBa_J119370 1 BBa_J119370 Ptac mutant -35 and -10 regions switched 2014-11-07T12:00:00Z 2015-08-31T04:08:28Z Synthetic oligonucleotides. This part was designed and clone by students in the Missouri Western State University Genetics class of Fall 2014. It was cloned into the pClone Red vector (BBa_J119137) using Golden Gate Assembly and synthetic oligonucleotides. The mutation switches the -35 and -10 regions. The mutation had a large effect on the function of the promoter (see Experience page). false false _613_435_ 0 606 61 Not in stock false Left sticky end of CGAC and right sticky end of CCGC. No BsaI sites allowed. false MWSU Genetics Fall 2014 Tuesday 2:00 lab annotation2430176 1 -35 sequence in -10 position range2430176 1 29 34 annotation2430175 1 -10 sequence in -35 position range2430175 1 7 12 BBa_J119370_sequence 1 gagctgtataatattaatcatcggctcgttgacagtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z