BBa_J119373 1 BBa_J119373 Ptac mutant -10 Region Shifted Upstream 7 bp 2014-11-07T12:00:00Z 2015-08-31T04:08:28Z Synthetic oligonucleotides. This part was designed and clone by students in the Missouri Western State University Genetics class of Fall 2014. It was cloned into the pClone Red vector (BBa_J119137) using Golden Gate Assembly and synthetic oligonucleotides. The mutation shifts the -10 region upstream 7 bp. The mutation had a large effect on the function of the promoter (see Experience page). false false _613_295_ 0 606 61 Not in stock false Left sticky end of CGAC and right sticky end of CCGC. No BsaI sites allowed. false MWSU Genetics Fall 2014 Thursday 8:00 lab annotation2430185 1 -35 region range2430185 1 7 12 annotation2430184 1 insertion of -10 range2430184 1 22 27 annotation2430186 1 deletion of -10 range2430186 1 35 40 BBa_J119373_sequence 1 gagctgttgacaattaatcattataatcggctcggtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z