BBa_J119377 1 BBa_J119377 Psimp2 Promoter with Four Consensus Variants 2015-03-27T12:00:00Z 2015-08-31T04:08:29Z Synthetic oligonucleotides cloned into pClone Red (BBa_J119137). Mutations were introduced into the Ptac promoter using NNNNNN in place of the TTGACA of the -35 region. Synthetic oligonucleotides carry the 4096 possible sequences were cloned via Golden Gate Assembly into pClone Red. A total of 81 different promoters were picked. The DNA sequence of the 81 mutant promoters was determined and their strength was measured by fluorometry (see BBa_J119375). A weighted method of consensus building was developed that assigned a score to each base in each -35 region based on the RFP expression of the mutant promoter that contained it. The resulting pClone -35 Consensus produced is shown below. <center> [[File:Ptac_-35_Consensus.png|500px|]] </center> Four variants of the consensus were cloned into a simplified promoter sequence to test the effect of sequence context surrounding the -35 region. The variants are GATAAA, GACAAA, GATATA, and GACATA. The simplified promoter is called Psimp1 and is derived from De Mey et al. (2007) MC Biotechnol 7:34. The Experience tab shows images and fluorescent data that show the strength of the Psimp1 promoter with the TTGACA consensus and four variants of the pClone -35 Consensus sequence. false false _613_ 0 606 61 Not in stock false The consensus sequence from De Mey et al. shown below was used to generate a promoter that has a simple sequence by using W=A, N=G, R=G, and D=G, but avoiding runs of 4 or more Gs or Cs. The resulting promoter was named Psimp1. <center> [[File:De_Mey_2007_Figure_1.jpg|750px|]] </center> false Anthony Eckdahl annotation2430573 1 -35 region range2430573 1 20 25 annotation2430571 1 -10 region range2430571 1 43 48 annotation2430572 1 pClone -35 Consensus Variants range2430572 1 20 25 BBa_J119377_sequence 1 cgacctccgcatttccttcttgacatcttccgccgcttatgatataatccgcccattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z