BBa_J119380 1 BBa_J119380 Ptac mutant T2-22ins 2015-04-05T11:00:00Z 2015-08-31T04:08:29Z Synthetic oligonucleotides This part was designed and clone by students in the Missouri Western State University Genetics class of Spring 2015. It was cloned into the pClone Red vector (BBa_J119137) using Golden Gate Assembly and synthetic oligonucleotides. The mutation inserts TAGACA at position -22. The mutation had a large effect on the function of the promoter (see Experience page). false false _613_ 0 606 61 Not in stock false None false MWSU Genetics Spring 2015 Tuesday 2:00 lab BBa_J119380_sequence 1 cgacgagctgttgacaattaattagacacatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z