BBa_J119404 1 BBa_J119404 Pupp Promoter 2017-02-23T12:00:00Z 2017-03-07T12:10:17Z Synthetic oligonucleotides cloned into P-Clone Red. This promoter is UTP sensitive and begins the transcription process of the upp gene in E. coli. false false _613_435_ 606 606 61 Not in stock false None. false Missouri Western Fall 2016 Genetics class, Lindsay Doolan annotation2532828 1 Pupp range2532828 1 1 40 BBa_J119404_sequence 1 aagaatattgccgccttgaagaaaggaggtataatccgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z