BBa_J119405 1 BBa_J119405 (pSB1A2-BR) Deletion of the original -35 sequence 2017-03-24T12:00:00Z 2017-03-24T11:53:56Z Part-sequence only (35 bp) AAGAATACCTTGAAGAAAGGAGGTATAATCCGTCG The Pupp promoter responds to UTP (see BBa_J100305). This mutant has a deletion of the original -35 element (TGCCGC) to test the effects on transcription with a different -35 sequence (AAGAAT). false false _613_191_ 0 606 606 61 Not in stock false The original -35 region, was deleted, but transcription was not terminated, the sequence just shifted, filling in a new sequence for the -35 region. false Lindsay Doolan and the fall 2016 Missouri Western Genetics class annotation2532897 1 deletion of the -35 region range2532897 1 1 5 annotation2532896 1 Pupp-35 element range2532896 1 8 13 BBa_J119405_sequence 1 aagaataccttgaagaaaggaggtataatccgtcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z