BBa_J119407 1 BBa_J119407 Pupp promoter mutant - Deletion of -10 element 2017-02-15T12:00:00Z 2017-02-21T12:32:58Z Synthetic oligonucleotides cloned into pClone Red (BBa_J119137). The Pupp promoter responds to UTP (see BBa_J100305). This mutant has a deletion of the original -10 element (TATAAT) to test the effects on transcription with a different -10 sequence (AGGAGG). false false _613_435_ 606 606 61 Not in stock false None false Christian Mackley and the fall 2016 Missouri Western State University Genetics class annotation2532818 1 Deletion of -10 element range2532818 1 29 30 annotation2532817 1 Pupp -35 element range2532817 1 8 13 BBa_J119407_sequence 1 aagaatattgccgccttgaagaaaggaggccgtcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z