BBa_J119408 1 BBa_J119408 Pupp promoter mutant - Substitution of C and G to A at 28 and 30 2017-02-21T12:00:00Z 2017-02-21T12:42:21Z Synthetic oligonucleotides cloned into pClone Red (BBa_J119137). The Pupp promoter responds to UTP (see BBa_J100305). This mutant has a substitution of C to A at the -28 and -30 to test the effects of transcription with a different -28 and -30 nucleotide. false false _613_71_ 606 606 61 Not in stock false None false Jacob Wagner and the Fall 2016 Missouri Western State University Genetics class annotation2532823 1 Pupp -35 element range2532823 1 8 13 annotation2532825 1 Substitution of G to A range2532825 1 13 13 annotation2532824 1 Substitution of C to A range2532824 1 11 11 annotation2532826 1 Pupp -10 element range2532826 1 31 36 BBa_J119408_sequence 1 aagaatattgacaccttgaagaaaggaggtataatccgtcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z