BBa_J120013 1 BBa_J120013 Sox10 binding site for Mitf promoter 2012-04-02T11:00:00Z 2015-08-31T04:08:29Z H. sapiens A short, twenty base pair DNA sequence which functions as a binding site for the Sox10 transcription factor of the Mitf promoter. When Sox10 is bound to this region, it induces production of the sequences encoded after it. false false _617_ 0 7766 9 Not in stock false N/A false Brett Fuller, Austin Jones, Jeremy Gerbig, Sindhu Adhikari, Coby Turner BBa_J120013_sequence 1 tgaaagagaaagaccattgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z