BBa_J120022 1 BBa_J120022 Phoratoxin 2012-04-02T11:00:00Z 2015-08-31T04:08:29Z Phoradendron tomentosum (California mistletoe) This is the 46 amino acid sequence for Phoratoxin, a thionin-type plant protein which are toxic to animal cells. They seem to exert their toxic effect at the level of the cell membrane, possibly through perforation of the membrane. Their precise function is not known. false false _617_ 0 12907 9 Not in stock false dunno at the moment... false Orijit Kar, Xiaoyang Feng, Stephen Cain, Sanjana Gurrala, Sahil Sharma BBa_J120022_sequence 1 aaaagctgctgcccgaccaccaccgcgcgcaacatttataacacctgccgctttggcggcggcagccgcccggtgtgcgcgaaactgagcggctgcaaaattattagcggcaccaaatgcgatagcggctggaaccattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z