BBa_J120023 1 BBa_J120023 ADAM17 Cleavage Sequence 2012-04-02T11:00:00Z 2015-08-31T04:08:29Z to edit later Please see design considerations for a proper "long description" because at this time, we do not know how to make future edits to long descriptions. Thanks, and good day! false false _617_ 0 12907 9 Not in stock false to edit later false Orijit Kar, Xiaoyang Feng, Stephen Cain, Sanjana Gurrala, Sahil Sharma BBa_J120023_sequence 1 ccgctggcgcaggcggtgcgcagcagcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z