BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_J120020 1 BBa_J120020 CH1 domain of human antibody 2012-04-02T11:00:00Z 2015-08-31T04:08:29Z write later write later false false _617_ 0 12298 9 Not in stock false write later false Xiaoyang Feng, Orijit Kar, Stephen Cain, Sanjana Gurrala, Sahil Sharma BBa_J120028 1 BBa_J120028 CH1 domain of human antibody + cleavage site + phoratoxin 2012-04-02T11:00:00Z 2015-08-31T04:08:29Z Will be done :P Device is composed of three subunits primarily constant region of ADAM17 antibody (M01), specific cleavage site that is recognized by the proteolytic function of ADAM17 and phoratoxin. These three subunits are arranged in corresponding order. A promoter with a variable region is required that will work in junction with the device. This variable region whose sequence is not known will recognize the ADAM17 present on the cell membrane of the cell and bind to it. The proteolytic function of ADAM17 will recognize the cleavage site and cleave it. This cleavage will result in releasing of phoratoxin which will enter the cell and eventually kill it. false false _617_ 0 12909 9 Not in stock false Will be done false Sanjana Gurrala, Xiaoyang Feng, Stephen Cain, Orijit Kar, Sahil Sharma component2172071 1 BBa_B0011 component2172070 1 BBa_J120022 component2172068 1 BBa_J120020 component2172069 1 BBa_J120023 annotation2172070 1 BBa_J120022 range2172070 1 328 468 annotation2172068 1 BBa_J120020 range2172068 1 1 297 annotation2172071 1 BBa_B0011 range2172071 1 469 514 annotation2172069 1 BBa_J120023 range2172069 1 298 327 BBa_J120023 1 BBa_J120023 ADAM17 Cleavage Sequence 2012-04-02T11:00:00Z 2015-08-31T04:08:29Z to edit later Please see design considerations for a proper "long description" because at this time, we do not know how to make future edits to long descriptions. Thanks, and good day! false false _617_ 0 12907 9 Not in stock false to edit later false Orijit Kar, Xiaoyang Feng, Stephen Cain, Sanjana Gurrala, Sahil Sharma BBa_J120022 1 BBa_J120022 Phoratoxin 2012-04-02T11:00:00Z 2015-08-31T04:08:29Z Phoradendron tomentosum (California mistletoe) This is the 46 amino acid sequence for Phoratoxin, a thionin-type plant protein which are toxic to animal cells. They seem to exert their toxic effect at the level of the cell membrane, possibly through perforation of the membrane. Their precise function is not known. false false _617_ 0 12907 9 Not in stock false dunno at the moment... false Orijit Kar, Xiaoyang Feng, Stephen Cain, Sanjana Gurrala, Sahil Sharma BBa_J120022_sequence 1 aaaagctgctgcccgaccaccaccgcgcgcaacatttataacacctgccgctttggcggcggcagccgcccggtgtgcgcgaaactgagcggctgcaaaattattagcggcaccaaatgcgatagcggctggaaccattga BBa_J120020_sequence 1 atggcaagcttcaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacccagacctacatctgcaacgtgaatcacaagcccagcaacaccaaggtggacaagaaagtt BBa_J120028_sequence 1 atggcaagcttcaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacccagacctacatctgcaacgtgaatcacaagcccagcaacaccaaggtggacaagaaagttccgctggcgcaggcggtgcgcagcagcagcaaaagctgctgcccgaccaccaccgcgcgcaacatttataacacctgccgctttggcggcggcagccgcccggtgtgcgcgaaactgagcggctgcaaaattattagcggcaccaaatgcgatagcggctggaaccattgaagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_J120023_sequence 1 ccgctggcgcaggcggtgcgcagcagcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z