BBa_J13022 1 BBa_J13022 AI-1+LasR dependent POPS/RIPS producer 2005-06-28T11:00:00Z 2015-08-31T04:08:29Z -- No description -- false false _37_ 0 88 37 Not in stock false false Jeff Tabor component1556554 1 BBa_I14016 component1556559 1 BBa_B0034 annotation1556559 1 BBa_B0034 range1556559 1 177 188 annotation1556554 1 BBa_I14016 range1556554 1 1 168 BBa_I14016 1 Las CIO P(Las) CIO 2004-07-29T11:00:00Z 2015-08-31T04:07:37Z Released HQ 2013 LasR and 3OC12HSL regulated promoter with CI Operator 1 (binding site for lambda cI repressor) false false _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1026125 1 -10 range1026125 1 140 145 annotation1017859 1 R0079 range1017859 1 1 151 annotation1026124 1 -35 range1026124 1 117 122 annotation1017878 1 CI lambda O1 range1017878 1 152 168 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I14016_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacactacctctggcggtgata BBa_B0034_sequence 1 aaagaggagaaa BBa_J13022_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacactacctctggcggtgatatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z