BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0065 1 cI+luxR Promoter (lambda cI and luxR regulated -- hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 cI repressor negatively regulates this promoter and LuxR activates its transcription.The effect of cI is dominant over LuxR. This part is based on the LuxR and cI repressor regulated hybrid promoter designed and tested by Ron Weiss. It requires the binding of two cI repressor dimers for maximal repression and contains two cI repressor binding sites namely, OR1 and OR2. This promoter is leaky in the sense that 'some' transcription is seen in the absence of both cI and LuxR. </P> <P>&nbsp;</P> <table width="75%" border="1"> <tr> <td><strong>LuxI</strong></td> <td><strong>cI</strong></td> <td><strong>activity of promoter</strong></td> </tr> <tr> <td>+</td> <td>+</td> <td>zero</td> </tr> <tr> <td>+</td> <td>-</td> <td>maximum</td> </tr> <tr> <td>-</td> <td>+</td> <td>zero</td> </tr> <tr> <td>-</td> <td>-</td> <td>leaky (no quantitative information)</td> </tr> </table> <P>&nbsp;</P> false false _1_ 0 24 7 In stock false <P> <P>This part was designed based on the LuxR and cI repressor regulated hybrid promoter tested by Ron Weiss and the LuxR-LuxICDABE sequence annotated by Tom Knight <genbank>AF170104</genbank>. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1986779 1 -35 range1986779 1 71 76 annotation1986778 1 lux p(R) start range1986778 1 58 58 annotation1986776 1 -10 range1986776 1 47 52 annotation1986777 1 OR2 cI range1986777 1 57 73 annotation1986780 1 OR1 cI range1986780 1 81 97 annotation1986775 1 Lux Box range1986775 1 6 25 annotation1986781 1 -10 range1986781 1 94 97 annotation1986774 1 BBa_R0065 range1986774 1 1 97 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J13025 1 BBa_J13025 3OC6HSL+LuxR dependent mRFP generator 2005-07-17T11:00:00Z 2015-08-31T04:08:29Z dominantly repressed by lambda cI false true _37_ 0 88 37 It's complicated false false Jeff Tabor component1586377 1 BBa_E1010 component1586370 1 BBa_B0034 component1586358 1 BBa_R0065 component1586393 1 BBa_B0012 component1586383 1 BBa_B0010 annotation1586370 1 BBa_B0034 range1586370 1 106 117 annotation1586383 1 BBa_B0010 range1586383 1 838 917 annotation1586358 1 BBa_R0065 range1586358 1 1 97 annotation1586377 1 BBa_E1010 range1586377 1 124 804 annotation1586393 1 BBa_B0012 range1586393 1 926 966 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation2214014 1 Help:Barcodes range2214014 1 682 706 annotation1014044 1 mrfp1 range1014044 1 1 675 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J13025_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgatatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_R0065_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z