BBa_J133700 1 BBa_J133700 primers tail extension EX for BioBricking 2011-06-23T11:00:00Z 2015-08-31T04:08:30Z Extend your cloning primers with BioBrick Prefix cutting sites (EcoRI-NotI-XbaI) by concatenating this sequence on the 5' end. Sequence is designed to minimize primer homodimers with itself, and heterodimer with BBa_J133701. false false _179_ 0 2680 9 Not in stock false false Norman Wang annotation2122794 1 NotI range2122794 1 9 16 annotation2122793 1 EcoRI range2122793 1 3 8 annotation2122795 1 XbaI range2122795 1 18 23 annotation2122792 1 2 extra bases for efficient EcoRI cutting range2122792 1 1 2 BBa_J133700_sequence 1 tggaattcgcggccgcttctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z