BBa_J133701 1 BBa_J133701 primers tail extension SP for BioBricking 2011-06-23T11:00:00Z 2015-08-31T04:08:30Z Extend your cloning primers with BioBrick Prefix cutting sites (SpeI-NotI-PstI) by concatenating this sequence on the 3' end. Sequence is designed to minimize primer homodimers with itself, and heterodimer with BBa_J133700. Make sure to order the primer in the correct 5'->3' orientation and the correct strand for the reverse primer! false false _179_ 0 2680 9 Not in stock false false Norman Wang annotation2122798 1 NotI range2122798 1 9 16 annotation2122799 1 PstI range2122799 1 16 21 annotation2122797 1 SpeI range2122797 1 2 7 annotation2122800 1 3 extra bases for efficient PstI cutting range2122800 1 22 24 BBa_J133701_sequence 1 tactagtagcggccgctgcaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z