BBa_J14012 1 BBa_J14012 coding region for genX 2006-06-11T11:00:00Z 2015-08-31T04:08:31Z DNA sequence information from company XYZ, Genbank accn X2345 This is the coding region for genX, a protein that when metabolized makes everything taste better false false _1_ 0 25 1 Not in stock false No design notes false Randy Rettberg BBa_J14012_sequence 1 aaattctttcctgggtttccaagtagcgcgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z