BBa_J15101 1 BBa_J15101 arsR coding sequence, Escherichia coli chromosomal ars repressor 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Escherichia coli K12 genomic sequence, based on X80057 (gi:510824). Escherichia coli chromosomal arsR coding sequence, which encodes the ArsR repressor. This binds to the ars promoter and represses it in the absence of arsenate or arsenite (Cai, J., and DuBow, M.S. 1996. Expression of the Escherichia coli chromosomal ars operon. Canadian Journal of Microbiology 42, 662-671; Diorio, C., Cai, J., Marmor, J., Shinder, R., and DuBow, M.S. 1995. An Escherichia coli chromosomal ars operon homolog is functional in arsenic detoxification and is conserved in Gram negative bacteria. Journal of Bacteriology 177, 2050-2056). false false _163_ 0 837 163 Not in stock false No modifications to the published sequence except that a second TAA stop codon was added in accordance with Registry recommendations. false Chris French annotation1938049 1 end arsR range1938049 1 352 354 annotation1938050 1 StuI range1938050 1 260 265 annotation1938048 1 start arsR range1938048 1 1 3 annotation1938047 1 arsR coding sequence range1938047 1 1 354 BBa_J15101_sequence 1 atgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z