BBa_J15102 1 BBa_J15102 lacZ' coding sequence 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Escherichia coli BS. The sequence was obtained from gi:146575. Released HQ 2013 Escherichia coli lacZ' coding sequence encoding the first 76 amino acids of LacZ (beta-galactosidase). This is sufficient to complement the lacZ-delta-M15 mutation found in commonly used laboratory strains of E. coli, thus allowing blue-white selection. It also can be used to effect a pH drop in the presence of lactose, as in the arsenic biosensor entered by the University of Ediburgh team for iGEM2006. false false _163_ 0 837 163 In stock false Codon 77, TGC, was changed to TAA to truncate the coding sequence. false Chris French annotation1938053 1 end lacZ range1938053 1 229 231 annotation1938051 1 lacZ' range1938051 1 1 231 annotation1938052 1 start lacZ' range1938052 1 1 3 BBa_J15102_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z