BBa_J15103 1 BBa_J15103 lacZ' coding sequence ending in TGA 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Eschericia coli BS. The sequence was derived from gi:146575. This is the same Escherichia coli lacZ' coding sequence as in BBa_J15102, encoding the N-terminal 76 amino acids of LacZ (beta galactosidase), except that it ends with TGA rather than the recommended TAATAA. It was mistakenly incorporated into several later constructs where we had intended to use BBa_J15012. It works exactly the same, but does not fully conform to the Registry recommendations for coding sequences. false false _163_ 0 837 163 Not in stock false Codon 77, normally TGC, was altered to TGA to truncate the sequence. false Chris French annotation1938054 1 lacZ' range1938054 1 1 231 annotation1938055 1 start lacZ' range1938055 1 1 3 annotation1938056 1 end lacZ' range1938056 1 229 231 annotation1938057 1 silent mutation codon 58 range1938057 1 174 174 BBa_J15103_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgagtggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z