BBa_J15101 1 BBa_J15101 arsR coding sequence, Escherichia coli chromosomal ars repressor 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Escherichia coli K12 genomic sequence, based on X80057 (gi:510824). Escherichia coli chromosomal arsR coding sequence, which encodes the ArsR repressor. This binds to the ars promoter and represses it in the absence of arsenate or arsenite (Cai, J., and DuBow, M.S. 1996. Expression of the Escherichia coli chromosomal ars operon. Canadian Journal of Microbiology 42, 662-671; Diorio, C., Cai, J., Marmor, J., Shinder, R., and DuBow, M.S. 1995. An Escherichia coli chromosomal ars operon homolog is functional in arsenic detoxification and is conserved in Gram negative bacteria. Journal of Bacteriology 177, 2050-2056). false false _163_ 0 837 163 Not in stock false No modifications to the published sequence except that a second TAA stop codon was added in accordance with Registry recommendations. false Chris French annotation1938049 1 end arsR range1938049 1 352 354 annotation1938050 1 StuI range1938050 1 260 265 annotation1938048 1 start arsR range1938048 1 1 3 annotation1938047 1 arsR coding sequence range1938047 1 1 354 BBa_J15201 1 BBa_J15201 rbs+arsR, E. coli chromosomal arsR repressor coding sequence with rbs. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z RBS synthetic; arsR from Escherichia coli K12, sequence derived from X80057 (gi:510824). This is the Escherichia coli chromosomail arsR coding sequence encoding the ArsR repressor, which represses the ars promoter in the absence of arsnate or arsenite (Cai, J., and DuBow, M.S. 1996. Expression of the Escherichia coli chromosomal ars operon. Canadian Journal of Microbiology 42, 662-671; Diorio, C., Cai, J., Marmor, J., Shinder, R., and DuBow, M.S. 1995. An Escherichia coli chromosomal ars operon homolog is functional in arsenic detoxification and is conserved in Gram negative bacteria. Journal of Bacteriology 177, 2050-2056) attached to a strong synthetic ribosome binding site BBa_J15001. Note the presence of a SacI site before the rbs, overlapping the XbaI site. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site at the 5' end of this construct, overlapping the XbaI site. This is preserved when this biobrick is added to any other biobrick, allowing easy testing for proper insertion by restriction digestion. false Chris French component1938060 1 BBa_J15001 component1938065 1 BBa_J15101 annotation1938065 1 BBa_J15101 range1938065 1 17 373 annotation1938060 1 BBa_J15001 range1938060 1 1 10 BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938045 1 SacI range1938045 1 1 3 annotation1938046 1 rbs range1938046 1 4 10 BBa_J15201_sequence 1 ctcaaggaggtactagatgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaataa BBa_J15001_sequence 1 ctcaaggagg BBa_J15101_sequence 1 atgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z