BBa_J15103 1 BBa_J15103 lacZ' coding sequence ending in TGA 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Eschericia coli BS. The sequence was derived from gi:146575. This is the same Escherichia coli lacZ' coding sequence as in BBa_J15102, encoding the N-terminal 76 amino acids of LacZ (beta galactosidase), except that it ends with TGA rather than the recommended TAATAA. It was mistakenly incorporated into several later constructs where we had intended to use BBa_J15012. It works exactly the same, but does not fully conform to the Registry recommendations for coding sequences. false false _163_ 0 837 163 Not in stock false Codon 77, normally TGC, was altered to TGA to truncate the sequence. false Chris French annotation1938054 1 lacZ' range1938054 1 1 231 annotation1938056 1 end lacZ' range1938056 1 229 231 annotation1938055 1 start lacZ' range1938055 1 1 3 annotation1938057 1 silent mutation codon 58 range1938057 1 174 174 BBa_J15202 1 BBa_J15202 rbs+lacZ' 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z RBS synthetic; lacZ' from Escherichia coli BS, sequence derived from gi:146575. Escherichia coli lacZ' gene encoding the first 77 amino acids of LacZ (beta galactosidase), with a strong synthetic ribosome binding site. Complements the common lacZ-delta-M15 mutation found in many laboratory strains of E. coli, allowing blue-white selection. Note the presence of a SacI site at the 5' end, overlapping the XbaI site; this is preserved when this biobrick is added to any other biobrick. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site at the 5' end, overlapping the XbaI site; this is preserved when this biobrick is added to any other biobrick. The lacZ' gene was truncated by alteration of codon 77 from TGC to TGA (note: not TAATAA as recommended, due to an error; however, the part works fine). false Chris French component1938068 1 BBa_J15001 component1938073 1 BBa_J15103 annotation1938068 1 BBa_J15001 range1938068 1 1 10 annotation1938073 1 BBa_J15103 range1938073 1 17 247 BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938045 1 SacI range1938045 1 1 3 annotation1938046 1 rbs range1938046 1 4 10 BBa_J15202_sequence 1 ctcaaggaggtactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgagtggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_J15001_sequence 1 ctcaaggagg BBa_J15103_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgagtggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z